
Editor in chief:黄宏文
Inauguration:
International standard number:ISSN
Unified domestic issue:CN
Domestic postal code:
- Most Read
- Most Cited
- Most Downloaded
SU Zhen-sheng , SU Wen-feng , YANG Bing-jian , ZHANG Li-juan , LI Ya-chao , BAI Yu-qing , YAN Chun , ZENG Hui-ming , ZHONG Tian-xiu
2015, 23(3):227-235. DOI: 10.11926/j.issn.1005-3395.2015.03.001
Abstract:In order to understand the function of SAHH in Kalanchoe daigremontiana, a cDNA sequence, named as KdSAHH, was cloned by RT-PCR and RACE-PCR. The results showed that the full-length of KdSAHH cDNA was 1748 bp, encoding 485 amino acids. The predicted molecular weight (MW) of KdSAHH was about 53 kDa with estimated pI of 5.59-5.682. The Scanprostie and DNAstar prediction showed that KdSAHH protein with two conserved motifs was very conservative in evolution. There were high homology between KdSAHH and SAHHs in other species by amino acid alignment, and which had the closest relationship with that in Medicago sativa. Lupinus luteus used as template, there were differences in three-dimensional structure of KdSAHH simulated by SWISS-MODLE and Phyre. These would lay out basis for research in expression and function of KdSAHH.
HUANG Yong-yi , TANG Min , ZHANG Zhi-rong , LI Zhi-lin , BI Yu-fen
2015, 23(3):236-244. DOI: 10.11926/j.issn.1005-3395.2015.03.002
Abstract:In order to understand the genetic diversity of Cymbidium tortisepulum, the fingerprints of 32 C. tortisepulum cultivars were constructed by SSR. The results showed that there were 95 alleles were detected by selected 12 pairs of primers, the number of alleles selected by one primers ranged from 4 to 18, and the number of mean alleles (NA) and effective alleles (NE) were 61.489 and 5.124, respectively. The Shannon information index (I) and polymorphism information content values (PIC) of 32 cultivars ranged from 0.806 to 2.624, and 0.789 to 0.953, respectively. Among 12 paris of primer, the primer SSR03 was the highest in NA, NE, observed heterozygosity (HO), I and PIC. All of 32 cultivars had different specific bands by 12 pairs of primer. The SSR molecular fingerprints of 32 cultivars were built by 3 core pairs of primers, including SSR02, SSR03 and SSR12. All of 32 cultivars could be distinguished each other by combined primers of SSR02 + SSR03 + SSR123. These would provide theoretical basis and technical support for studying in the identification of C. tortisepalum cultivars, genetic diversity analysis and molecular breeding.
GAO Zhi-min , LOU Yong-feng , WANG Li-li , YANG Li , ZHAO Han-sheng , CHEN Dong-liang
2015, 23(3):245-251. DOI: 10.11926/j.issn.1005-3395.2015.03.003
Abstract:In order to understand the function of DlAP2 in Dendrocalamus latiflorus, one miR172a targeted gene named as DlAP2 was cloned from D. latiflorus by RT-PCR and RACE. Sequence analysis showed that the full length cDNA of DlAP2 was 1729 bp, including 5' untranslated region (UTR) 81 bp, open reading frame (ORF) 1464 bp, 3' UTR 351 bp, 24 bp polyA, and one miR172a complementary site (CTGCAGCATCATCAGGATTCT) at 130 bp of the 3' end in ORF. DlAP2 encodes a putative protein with 487 amino acids with two AP2 domains, which indicate that it belongs to AP2 group of AP2 subfamily in AP2/ERF family. DlAP2 has a high homology with those AP2 from other monocots. RLM-5' RACE analysis showed that DlAP2 was regulated by miR172a through cutting mainly at the site between the 11th and 12th bases. Real-time quantitative PCR results showed that the expression pattern of DlAP2 was opposite to that of miR172a in flower buds. These validated that miR172a played a regulatory role in regulating the expression of DlAP2.
LIN Sheng , CHEN Ting , ZHOU Ming-ming , CHEN Guan-shui , LIN Wen-xiong
2015, 23(3):252-261. DOI: 10.11926/j.issn.1005-3395.2015.03.004
Abstract:In order to understand the interaction proteins with SoSGT1 during chewing cane (Saccharum officenarum L.) in denfense Gibberella fujikuroi, SoSgt1 and vector pGEX-6p-1 was used to construct vector pGEX-6p-1-sgt1, which expressed fusion protein of GST-SoSGT1. Seven proteins were obtained by GST pull down. The function of these proteins was classified into signal transduction, stress resistance and energy metabolism, in which might directly interact with SoSGT1, such as HSP90 and RAR1, and others might indirectly interact with SoSGT1. When the leaves of chewing cane ‘Fuan’ were infected by G. fujikuroi, the expression of coding genes of HSP70, 14-3-3 protein, 2-Cys-peroxiredoxin and pyridoxine biosynthesis protein was up-regulated, which indicated that these proteins might interact with SoSGT1 and associate with the resistance of chewing cane to G. fujikuroi.
LU Luan-mei , WU Fu-mei , ZHANG Qiong , LIN Jin-shui , BIAN A-na
2015, 23(3):262-267. DOI: 10.11926/j.issn.1005-3395.2015.03.005
Abstract:The aim was to analyze the salt resistance of Ixora collinea ‘Gillettese How’. The growth and physiology indexes in ‘Gillettese How’ seedlings were studied under NaCl stress. The results showed that the seedling growth was inhibited significantly under salt stress. The MDA and proline contents, relative electric conductivity and membrane damage increased, and they had significant positive correlations with NaCl concentration. The contents of chlorophyll and soluble protein in leaf decreased and negative correlation with NaCl concentration. However, there were no significant correlation between soluble sugar content, superoxide dismutase (SOD) activity and NaCl concentration. The growth of ‘Gillettese How’ was inhibited weakly under low NaCl stress (0.2%-0.6%), but it was affected greatly under high NaCl (0.8%-1.5%) stress.
2015, 23(3):268-276. DOI: 10.11926/j.issn.1005-3395.2015.03.006
Abstract:Delphinium liangshanense W. T. Wang and D. leiostachyum W. T. Wang (Ranunculaceae) were described respectively from Yuexi and Muli in southwestern Sichuan, China. Both herbarium and field observations have shown that they represent no more than a taller form of D. autumnale Hand.-Mazz., a species previously recorded to occur in southwestern Sichuan (Muli, Yanyuan) and northwestern Yunnan (Ninglang). We therefore reduce them to the synonymy of D. autumnale.
2015, 23(3):277-283. DOI: 10.11926/j.issn.1005-3395.2015.03.007
Abstract:Examination of herbarium specimens has shown that Anemone yulongshanica W. T. Wang var. glabrescens W. T. Wang (Ranunculaceae) is identical with A. obtusiloba D. Don ssp. leiophylla W. T. Wang. We therefore reduce the former to the synonymy of the latter.
WANG Qiu-shi , WANG Yuan , YAN Xiao-ling , ZENG Xian-feng , MA Jin-shuang , LI Hong-qing
2015, 23(3):284-288. DOI: 10.11926/j.issn.1005-3395.2015.03.008
Abstract:Amaranthus dubius Mart. ex Thell., native to tropical America and the West Indies, introduced and naturalized in Europe, tropical Asia and Africa as well as in Taiwan, has been found in mainland of China. The population of A. dubius has been discovered along the bank of Hanjiang River of Chaozhou, Guangdong Province, China. The biological characters and the potential invasive were discussed, and a taxonomic key for Chinese Amaranthus is provided.
HUANG Yu-song , ZENG Wei-bo , GUO Jing , HUANG Xin-yi , LIU Yan
2015, 23(3):289-294. DOI: 10.11926/j.issn.1005-3395.2015.03.009
Abstract:Calanthe longgangensis Y. S. Huang & Yan Liu, a new species from southwestern Guangxi, China is described and illustrated. Based on morphological characters, it is similar to C. alismifolia Lindl., but differs in its rhizome conspicuous, lateral sepals upward reflexed, petals overlapping, lateral lobes of lip oblanceolate, apex obliquely truncate, mid-lob apex shallowly 2-lobed, disk with multiseriate white, wartlike calli at base, pollinia clavate.
MO Ai-qiong , HU Xiao-ying , GAO Li-xia
2015, 23(3):295-300. DOI: 10.11926/j.issn.1005-3395.2015.03.010
Abstract:In order to understand the morphological characteristics of flowers of blueberry (Vaccinium spp.), the flowers of two cultivars ‘Gardenblue’ and ‘Sharpblue’ were observed using Zeiss SV11 stereomicroscope and JSM-6360LV scanning electron microscope. The results showed that the filaments are flattened and pilose. The glandular trichome of ‘Gardenblue’ filament is short and the epidermal cells in the base of filaments are nearly rectangle. The glandular trichomes on the surface of ‘Sharpblue’ filaments are more slender and denser, and the epidermal cells in base of filament are nearly prismatic. Four virgate anthers arrange symmetrically, with the connectivum clearly visible between two anthers at the same side. The epidermal cells of anthers are papillate. Two tubulars are located on the top of mature anthers dehiscingby pores. The stigmas are flattened, belonging to wet type stigmas. The pollen is in tetrads and grains are with rugulate ornamentation and several hollows, tetrahedral shape and middle size. The aperture gaps have differences among pollen grains in length, width, length and shape of lid, and extent of protuberances. The surface of ‘Gardenblue’ stigma has papillate cells. The epidermal cells of styles are cylindrical, fasciculate and detached. Striated papillate cells exist on the surface of ‘Sharpblue’ stigma, and the epidermal cells of styles are cylindrical, with its long axis parallel to style. These would provide a botanical basis for further study on classification and phylogenetic evolution of Vaccinium spp.
LIAN Ming , LÜ Shi-dong , WU Yuan-shuang , ZHOU Jiang-sheng , WANG Chen , MENG Qing-xiong
2015, 23(3):301-309. DOI: 10.11926/j.issn.1005-3395.2015.03.011
Abstract:In order to explore the volatile components in four kinds of black tea from China, including Dianhong, Qihong, Zhengshanxiaozhong and Jinjunmei, their volatile components were extracted by fully automated headspace solid-phase microextraction (HS-SPME) and identified by gas chromatography-mass spectrometry (GC-MS). The results showed that total 90 volatile constituents were identified from four kinds of black tea. The major volatile components in Dianhong tea were linalool, geraniol, linalool oxides, methyl salicylate, 2-pentylfuran, and nerolidol; which in Qihong tea were hexadecanoic acid, phytone, geraniol, linalool oxides, β-ionone, phytol, and anthracene; phytone, geraniol, β-ionone, dihydroactinidiolide, caffeine, and linalool oxides in Zhengshanxiaozhong black tea; and geraniol, caffeine, linalool oxides, β-ionone, phenethyl alcohol, nerolidol, and phytol in Jinjunmei black tea. The common volatiles included benzaldehyde, phenylacetaldehyde, linalool oxides, linalool, geraniol, α-ionone, β-ionone, phytol, etc. The volatile compositions and contents had great differences among four kinds of black tea, only 32 compounds were common. The relative content of alcohol compounds in four black teas was high, counting for 69.08% in Dianhong tea, while that of ketone compounds was high in Qihong, Zhengshanxiaozhong, and Jinjunmei. The differences in volatile compound proportion and threshold value formed the unique aroma characteristics of these black teas.
TIWALADE Adegoke Adelakun , LI Xiao-xia , QU Lu , CHEN Yue , WANG Tao , ZHANG Yi
2015, 23(3):310-316. DOI: 10.11926/j.issn.1005-3395.2015.03.012
Abstract:In order to understand the chemical constituents of Rosmarinus officinalis, 13 compounds were isolated from its 95% EtOH extract. On the basis of spectral data, their structures were identified as (Z)-3- hexenyl glucoside (1), (Z)-3-hexenyl O-β-D-glucopyranosyl-(1''→6')-β-D-glucopyranoside (2), erythritol-1-O- (6-O-trans-caffeoyl)-β-D-glucopyranoside (3), 2,3,4,5-tetrahydroxyhexyl-6-O-trans-caffeoyl-β-glucopyranoside (4), 1,2,3,4-tetrahydroxy-2-methylbutane-4-O-(6-O-trans-caffeoyl)-β-D-glucopyranoside (5), caffeic acid (6), rosmarinic acid (7), methyl rosmarinate (8), methyl benzoate-4-β-glucoside (9), benzyl-β-D-glucopyranoside (10), benzyl-O-β-D-apiofuranosyl-(1→2)-β-D-glucopyranoside (11), 1,2-di-O-β-D-glucopranosyl-4-allylbenzene (12) and (+)-syringaresinol-4'-O-β-D-glucopyranoside (13). Among them, compounds 1-5 and 8-13 were isolated from the Rosmarinus genus for the first time. For the known ones, the NMR data of compound 13 was corrected.
ZHANG You-yuan , SONG Xi-qiang , MEI Wen-li , ZUO Wen-jian , CAI Cai-hong , CHENG Jin , DAI Hao-fu
2015, 23(3):317-322. DOI: 10.11926/j.issn.1005-3395.2015.03.013
Abstract:The aim was to understand the chemical constituents of Dendrobium hainanense. Fourteen compounds were isolated from its aerial parts by means of chromatographic techniques. On the basis of spectral data, they were identified as: 2,6-dimethoxy-p-benzoquinone (1), (+)-dehydrovomifoliol (2), blumenol A (3), erianthridin (4), nudol (5), 3,7-dihydroxy-2,4-dimethoxy-phenanthrene (6),3-hydroxy-2,4,7-trimethoxy-9,10-dihydrophenanthrene (7), 3-hydroxy-2,4,7-trimethoxy-9,10-dihydro-phenanthrene (8), 3,4,7-trihydroxy-2-methoxyphenanthrene (9), 3,7-dihydroxy-2,4-dimethoxy-9,10-dihydro-phenanthrene (10), (+)-lyoniresinol (11), (+)- syringaresinol (12), denchrysan A (13) and nobilone (14). All compounds were isolated from D. hainenense for the first time. Compounds 4-6, 8-9, 11 and 14 showed weak inhibitory activity against acetylcholinesterase.
YU Hai-qian , BAI Hong-jin , MEI Wen-li , ZUO Wen-jian , WANG Hao , YANG Jin-ling , DAI Hao-fu
2015, 23(3):323-328. DOI: 10.11926/j.issn.1005-3395.2015.03.014
Abstract:In order to understand the chemical constituents of Trigonostemon lutescens, eleven compounds were isolated from its 95% EtOH extract by silica gel and sephadex LH-20 column chromatography. On the basis of spectral data, they were identified as ent-kaurane-3β,16β-diol (1), (3R,6R,7E)-3-hydroxy-4,7-megastigmadien-9-one (2), palmarumycin JC2 (3), (±)-3-(3,4,5-trimethoxyphenyl)-1,2-propanediol (4), erythro-guaiacylglycerol-β-O-4'-coniferyl ether (5), threo-guaiacylglycerol-β-O-4'-coniferyl ether (6), 3-hydroxymethyl-5-(3-hydroxypropyl)- 7-methoxy-2-{3-methoxy-4-[1-(3,4-dimethoxybenzyl)-2-hydroxyethyl]phenyl}-2,3-dihydrobenzofuran (7), ancistrocline (8), hamatine (9), scopolin (10), syringin (11). All the compounds were isolated from this plant for the first time, and they were isolated from the genus Trigonostemon for the first time except of compound 12.
HUANG Miao , MEI Wen-li , CAI Cai-hong , WANG Hui , DONG Wen-hua , QU You-le , DAI Hao-fu
2015, 23(3):329-333. DOI: 10.11926/j.issn.1005-3395.2015.03.015
Abstract:In order to understand the antitumor active ingredients of Aphanamixis grandifolia Bl., nine compounds were isolated from 95% ethanol extract of its roots. They were identified as 7-hydroxycadalene (1), dregeana-1 (2), 4-oxopinoresinol (3), 4-ketopinoresinol (4), 6-deoxyjacareubin (5), schleicheol 1 (6), stigmasterol (7), β-sitosterol (8), and daucosterol (9) on the basis of spectral data. Compounds 1-6 were isolated from the genus Aphanamixis for the first time, and the 13C NMR spectral data of compound 1 was reported for the first time. Compounds 1 and 5 showed inhibition of the proliferation of K562 cell line, and compounds 1,5 and 6 possessed inhibitory activity against SGC-7901 cell line.
SHANG Tian-qi , ZHENG Chao-chao , GAO Hong-di , YE Nuo-nan , YI Li-ta
2015, 23(3):334-342. DOI: 10.11926/j.issn.1005-3395.2015.03.016
Abstract:In order to explain the internal relationship between distribution patterns of vegetation and environment, the numerical classification and ordination of 94 plots (20 m×20 m for each) in public welfware forest of Shengzhou were studied by two-way indicator species analysis (TWINSPAN) and canonical correspondence analysis (CCA). The results showed that 94 plots could be divided into 14 groups by TWINSPAN, and in which the associations of Pinus massonian as constructive species was the most, it was dominant community type in the region. The relationship between vegetation communities and environmental factors was reflected by CCA ordination, the slop aspect and slop position were main environment factors in the community distribution. Therefore, the internal relationship between distribution patterns of vegetation and environment could be explained by combination of both methods, these could provide scientific foundation for the classification management of regional public welfare forest.
HAN Shi-zhong , GAO Ren , MA Hong-liang , YIN Yun-feng , SI You-tao , YANG Yu-sheng , CHEN Shi-dong , LU Jian-fang , LIU Gong-hui , LI Ai-ping , ZHENG Qun-rui
2015, 23(3):343-352. DOI: 10.11926/j.issn.1005-3395.2015.03.017
Abstract:In order to understand the soil fungal diversity in mid-subtropical forest, the soil fungal community structure of Castanopsis carlesii nature forests in Wuyi Mountain and Jian'ou Wanmulin Nature Reserves at northern Fujian, eastern China was studied by PCR-DGGE molecular fingerprint techniques. The results showed that the diversity index, richness index and evenness index of soil fungal in the two subtropical forests were 3.37-3.80, 26-29 and 0.977-0.984, respectively, indicating that the natural forest soil fungal communities were abundant. Thirty-nine fungi species were obtained by sequencing and homologous alignment, among which Basidiomycota were the most, accounting for 35.9%; followed by Ascomycota for 15.4%, then Zygomycota for 10.3% and Deuteromycota for 7.7%. Principal component analysis showed both soil depth and sample location were the major factors influencing fungal community composition, and the effect of location was bigger than soil depth. Correlation analysis showed that soil fungal diversity index had significant positive correlation with ammonium nitrogen content and negative with carbon nitrogen ratio, nevertheless, the community richness index and evenness index showed no significant relation with the soil factors. So, the carbon and nitrogen contents in soil were important factors affecting the soil fungal community structure.
SUN Su-jing , LI Fang-lan , BAO Wei-kai
2015, 23(3):353-360. DOI: 10.11926/j.issn.1005-3395.2015.03.018
Abstract:In order to understand the research status of leaf venation system, the regulation mechanisms of leaf venation development by genes and hormones were reviewed, and the function of leaf venation and its significance were analyzed. The effects of environment factors, such as light, temperature, water, on the structure characters (density, diameter of leaf venation) was also analyzed. Meantime, comprehensive consideration of plant carbon into economic trade-offs, it was clarified that leaf venation system was constructed co-regulated by environment and carbon input based on genetic control. At last, the problems and future direction in studying of leaf venation system were prospected.
Editor in chief:黄宏文
Inauguration:
International standard number:ISSN
Unified domestic issue:CN
Domestic postal code: