Cloning and Expression Analysis of miR172a Targeted Gene DlAP2 in Dendrocalamus latiflorus

Abstract:

In order to understand the function of DlAP2 in Dendrocalamus latiflorus, one miR172a targeted gene named as DlAP2 was cloned from D. latiflorus by RT-PCR and RACE. Sequence analysis showed that the full length cDNA of DlAP2 was 1729 bp, including 5' untranslated region (UTR) 81 bp, open reading frame (ORF) 1464 bp, 3' UTR 351 bp, 24 bp polyA, and one miR172a complementary site (CTGCAGCATCATCAGGATTCT) at 130 bp of the 3' end in ORF. DlAP2 encodes a putative protein with 487 amino acids with two AP2 domains, which indicate that it belongs to AP2 group of AP2 subfamily in AP2/ERF family. DlAP2 has a high homology with those AP2 from other monocots. RLM-5' RACE analysis showed that DlAP2 was regulated by miR172a through cutting mainly at the site between the 11^th and 12^th bases. Real-time quantitative PCR results showed that the expression pattern of DlAP2 was opposite to that of miR172a in flower buds. These validated that miR172a played a regulatory role in regulating the expression of DlAP2.